n benthamiana Search Results


90
BIOREBA Inc tsp extracts from n. benthamiana
Tsp Extracts From N. Benthamiana, supplied by BIOREBA Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+benthamiana/tsp+extracts+from+n++benthamiana/pmc06640260-159-39-49
Average 90 stars, based on 1 article reviews
tsp extracts from n. benthamiana - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
RLP AgroScience n. benthamiana
N. Benthamiana, supplied by RLP AgroScience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+benthamiana/n++benthamiana/pmc02663746-382-17-5
Average 90 stars, based on 1 article reviews
n. benthamiana - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Boyce Thompson Institute for Plant Research Inc n. benthamiana genome
Schematics of the procedure to identify NBS domain-containing proteins in N. <t>benthamiana</t> annotated genome. HMMsearch of N. benthamiana annotated proteins using the standard Pfam NBS HMM led to the identification of 309 NBS-containing candidates. The 309 NBS domains were aligned using ClustalW and used to build a N. benthamiana -specific NBS HMM, which was subsequently used to screen again the N. benthamiana annotated proteins. However, no new candidates were identified in the 268 entries generated. N. benthamiana annotated proteins were further searched by BLASTp using the 309 candidates. New R gene candidates were further selected and screened for the presence of NBS, LRR and TIR domains using HMMscan
N. Benthamiana Genome, supplied by Boyce Thompson Institute for Plant Research Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+benthamiana/n++benthamiana+genome+sequencing+data/pmc05408436-42-27-10
Average 90 stars, based on 1 article reviews
n. benthamiana genome - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Kentucky Bioprocessing n. benthamiana seeds
Schematics of the procedure to identify NBS domain-containing proteins in N. <t>benthamiana</t> annotated genome. HMMsearch of N. benthamiana annotated proteins using the standard Pfam NBS HMM led to the identification of 309 NBS-containing candidates. The 309 NBS domains were aligned using ClustalW and used to build a N. benthamiana -specific NBS HMM, which was subsequently used to screen again the N. benthamiana annotated proteins. However, no new candidates were identified in the 268 entries generated. N. benthamiana annotated proteins were further searched by BLASTp using the 309 candidates. New R gene candidates were further selected and screened for the presence of NBS, LRR and TIR domains using HMMscan
N. Benthamiana Seeds, supplied by Kentucky Bioprocessing, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+benthamiana/n++benthamiana+seeds/pm28369753-164-26-16
Average 90 stars, based on 1 article reviews
n. benthamiana seeds - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
HCPro Inc hcpro-supplied n. benthamiana plants
Schematics of the procedure to identify NBS domain-containing proteins in N. <t>benthamiana</t> annotated genome. HMMsearch of N. benthamiana annotated proteins using the standard Pfam NBS HMM led to the identification of 309 NBS-containing candidates. The 309 NBS domains were aligned using ClustalW and used to build a N. benthamiana -specific NBS HMM, which was subsequently used to screen again the N. benthamiana annotated proteins. However, no new candidates were identified in the 268 entries generated. N. benthamiana annotated proteins were further searched by BLASTp using the 309 candidates. New R gene candidates were further selected and screened for the presence of NBS, LRR and TIR domains using HMMscan
Hcpro Supplied N. Benthamiana Plants, supplied by HCPro Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+benthamiana/hcpro+supplied+n++benthamiana+plants/10__1128_slash_jvi__01010___14-92-12-12
Average 90 stars, based on 1 article reviews
hcpro-supplied n. benthamiana plants - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Berrimah Veterinary n. benthamiana seedlings
<t> N. benthamiana </t> plants sown into CGMMV infested soil and tested for the presence of CGMMV.
N. Benthamiana Seedlings, supplied by Berrimah Veterinary, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+benthamiana/n++benthamiana+seedlings/pmc09003373-158-2-14
Average 90 stars, based on 1 article reviews
n. benthamiana seedlings - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Boyce Thompson Institute for Plant Research Inc positive control construct targeting the n. benthamiana drm3 gene (grna: gccactatctggccggggac)
<t> N. benthamiana </t> plants sown into CGMMV infested soil and tested for the presence of CGMMV.
Positive Control Construct Targeting The N. Benthamiana Drm3 Gene (Grna: Gccactatctggccggggac), supplied by Boyce Thompson Institute for Plant Research Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+benthamiana/positive+control+construct+targeting+the+n++benthamiana+drm3+gene++grna++gccactatctggccggggac+/bio_rxiv__2020__08__04__237180-235-5-22
Average 90 stars, based on 1 article reviews
positive control construct targeting the n. benthamiana drm3 gene (grna: gccactatctggccggggac) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Boyce Thompson Institute for Plant Research Inc wild-type (wt) plants of n. benthamiana
Survival rate of bioassays using specific stages of larval instars on WT and ASAT2 plants of N. <t>benthamiana</t> . Values are presented as means ± SE. Asterisks above error bars indicate significant differences ( P < 0.05).
Wild Type (Wt) Plants Of N. Benthamiana, supplied by Boyce Thompson Institute for Plant Research Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+benthamiana/wild+type++wt++plants+of+n++benthamiana/pmc09478178-41-11-17
Average 90 stars, based on 1 article reviews
wild-type (wt) plants of n. benthamiana - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Boyce Thompson Institute for Plant Research Inc n. benthamiana line
The size distribution of sequenced small RNA reads. The size class distribution of redundant and non redundant small RNA sequences in the twelve tissue samples. The percentage of the different size classes (y-axis) and the different tissues, which includes seedling, root, leaf, stem and flower with biological replicates and BTI seedling and leaf cDNA libraries (x-axis) represented in N. <t>benthamiana</t>
N. Benthamiana Line, supplied by Boyce Thompson Institute for Plant Research Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+benthamiana/n++benthamiana+line/pmc04667520-220-34-58
Average 90 stars, based on 1 article reviews
n. benthamiana line - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Boyce Thompson Institute for Plant Research Inc n. benthamiana asko seeds
The size distribution of sequenced small RNA reads. The size class distribution of redundant and non redundant small RNA sequences in the twelve tissue samples. The percentage of the different size classes (y-axis) and the different tissues, which includes seedling, root, leaf, stem and flower with biological replicates and BTI seedling and leaf cDNA libraries (x-axis) represented in N. <t>benthamiana</t>
N. Benthamiana Asko Seeds, supplied by Boyce Thompson Institute for Plant Research Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+benthamiana/n++benthamiana+asko+seeds/pm39548114-264-1-13
Average 90 stars, based on 1 article reviews
n. benthamiana asko seeds - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Kaltenbach GmbH n. benthamiana dcl2/4i
Aphids infesting strawberry plants and experimental host plants of strawberry viruses determined in the present study.
N. Benthamiana Dcl2/4i, supplied by Kaltenbach GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+benthamiana/n++benthamiana+dcl2+4i/pmc06893435-115-32-2
Average 90 stars, based on 1 article reviews
n. benthamiana dcl2/4i - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
iBio Inc transient n. benthamiana
Plant-produced recombinant proteins on the market
Transient N. Benthamiana, supplied by iBio Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+benthamiana/transient+n++benthamiana/pmc10030082-2-5-12
Average 90 stars, based on 1 article reviews
transient n. benthamiana - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


Schematics of the procedure to identify NBS domain-containing proteins in N. benthamiana annotated genome. HMMsearch of N. benthamiana annotated proteins using the standard Pfam NBS HMM led to the identification of 309 NBS-containing candidates. The 309 NBS domains were aligned using ClustalW and used to build a N. benthamiana -specific NBS HMM, which was subsequently used to screen again the N. benthamiana annotated proteins. However, no new candidates were identified in the 268 entries generated. N. benthamiana annotated proteins were further searched by BLASTp using the 309 candidates. New R gene candidates were further selected and screened for the presence of NBS, LRR and TIR domains using HMMscan

Journal: Plant Methods

Article Title: A novel hairpin library-based approach to identify NBS–LRR genes required for effector-triggered hypersensitive response in Nicotiana benthamiana

doi: 10.1186/s13007-017-0181-7

Figure Lengend Snippet: Schematics of the procedure to identify NBS domain-containing proteins in N. benthamiana annotated genome. HMMsearch of N. benthamiana annotated proteins using the standard Pfam NBS HMM led to the identification of 309 NBS-containing candidates. The 309 NBS domains were aligned using ClustalW and used to build a N. benthamiana -specific NBS HMM, which was subsequently used to screen again the N. benthamiana annotated proteins. However, no new candidates were identified in the 268 entries generated. N. benthamiana annotated proteins were further searched by BLASTp using the 309 candidates. New R gene candidates were further selected and screened for the presence of NBS, LRR and TIR domains using HMMscan

Article Snippet: Taking advantage of the availability of the N. benthamiana genome (Boyce Thompson Institute for Plant Research—Genbank: PRJNA170566), sequences of most of the potential R genes of the N. benthamiana genome were identified based on the presence of an NBS domain and used to create an RNAi knock-out library.

Techniques: Generated

Hairpin library design. a A total of 281 Kmers were designed, with 202 Kmers targeting a unique gene of N. benthamiana annotated genome with 100% identity, and 79 kmers targeting two or more genes. b To produce multiple gene silencing constructs, groups of six kmers were synthesized in tandem (4 “singles” and 2 “multiple”), cloned in a Gateway-enabled pUC57 vector and eventually recombined by LR reaction into the hairpin-producing destination vector pTKO2

Journal: Plant Methods

Article Title: A novel hairpin library-based approach to identify NBS–LRR genes required for effector-triggered hypersensitive response in Nicotiana benthamiana

doi: 10.1186/s13007-017-0181-7

Figure Lengend Snippet: Hairpin library design. a A total of 281 Kmers were designed, with 202 Kmers targeting a unique gene of N. benthamiana annotated genome with 100% identity, and 79 kmers targeting two or more genes. b To produce multiple gene silencing constructs, groups of six kmers were synthesized in tandem (4 “singles” and 2 “multiple”), cloned in a Gateway-enabled pUC57 vector and eventually recombined by LR reaction into the hairpin-producing destination vector pTKO2

Article Snippet: Taking advantage of the availability of the N. benthamiana genome (Boyce Thompson Institute for Plant Research—Genbank: PRJNA170566), sequences of most of the potential R genes of the N. benthamiana genome were identified based on the presence of an NBS domain and used to create an RNAi knock-out library.

Techniques: Construct, Synthesized, Clone Assay, Plasmid Preparation

Pto/avrPto-triggered HR is cancelled by hp#12 pre-infiltration. a General design of the assay: N. benthamiana leaf was infiltrated with Agrobacterium containing the hairpin construct or corresponding empty vector (EV) in two distinct patches on the right-hand side and left hand side of the leaf respectively and infiltration areas were marked with a felt-tip pen. The following day, Agrobacterium containing the effector construct, or corresponding empty vector (EV), were infiltrated in the pre-infiltrated patches of the top half and bottom half of the leaf respectively. Development of the HR was monitored during the following 3–7 days depending on the strength of the HR. b Agrobacterium suspension (OD 0.2) carrying the hairpin hp#12 or corresponding empty vector was infiltrated in N. benthamiana leaf and the Agrobacterium suspension (OD 0.2) expressing the Pto/avrPto construct was infiltrated 24 h later on the pre-infiltrated patches as designed in ( a ). Photos was taken 4 days after Pto/avrPto infiltration

Journal: Plant Methods

Article Title: A novel hairpin library-based approach to identify NBS–LRR genes required for effector-triggered hypersensitive response in Nicotiana benthamiana

doi: 10.1186/s13007-017-0181-7

Figure Lengend Snippet: Pto/avrPto-triggered HR is cancelled by hp#12 pre-infiltration. a General design of the assay: N. benthamiana leaf was infiltrated with Agrobacterium containing the hairpin construct or corresponding empty vector (EV) in two distinct patches on the right-hand side and left hand side of the leaf respectively and infiltration areas were marked with a felt-tip pen. The following day, Agrobacterium containing the effector construct, or corresponding empty vector (EV), were infiltrated in the pre-infiltrated patches of the top half and bottom half of the leaf respectively. Development of the HR was monitored during the following 3–7 days depending on the strength of the HR. b Agrobacterium suspension (OD 0.2) carrying the hairpin hp#12 or corresponding empty vector was infiltrated in N. benthamiana leaf and the Agrobacterium suspension (OD 0.2) expressing the Pto/avrPto construct was infiltrated 24 h later on the pre-infiltrated patches as designed in ( a ). Photos was taken 4 days after Pto/avrPto infiltration

Article Snippet: Taking advantage of the availability of the N. benthamiana genome (Boyce Thompson Institute for Plant Research—Genbank: PRJNA170566), sequences of most of the potential R genes of the N. benthamiana genome were identified based on the presence of an NBS domain and used to create an RNAi knock-out library.

Techniques: Construct, Plasmid Preparation, Suspension, Expressing

TMV-induced hypersensitive response (HR) in N -infiltrated leaves is cancelled by NRG1 silencing. Hairpins hp#26 or u135 or the corresponding empty vector were co-infiltrated with N in N. benthamiana leaves and the infiltrated areas were marked with a felt-tip pen. TMV was inoculated 24 h after Agrobacterium infiltration. HR was visible from 4 days after TMV inoculation and photo were taken 6 days post-inoculation. H 2 O 2 production in the same leaves was monitored using DAB staining

Journal: Plant Methods

Article Title: A novel hairpin library-based approach to identify NBS–LRR genes required for effector-triggered hypersensitive response in Nicotiana benthamiana

doi: 10.1186/s13007-017-0181-7

Figure Lengend Snippet: TMV-induced hypersensitive response (HR) in N -infiltrated leaves is cancelled by NRG1 silencing. Hairpins hp#26 or u135 or the corresponding empty vector were co-infiltrated with N in N. benthamiana leaves and the infiltrated areas were marked with a felt-tip pen. TMV was inoculated 24 h after Agrobacterium infiltration. HR was visible from 4 days after TMV inoculation and photo were taken 6 days post-inoculation. H 2 O 2 production in the same leaves was monitored using DAB staining

Article Snippet: Taking advantage of the availability of the N. benthamiana genome (Boyce Thompson Institute for Plant Research—Genbank: PRJNA170566), sequences of most of the potential R genes of the N. benthamiana genome were identified based on the presence of an NBS domain and used to create an RNAi knock-out library.

Techniques: Plasmid Preparation, Staining

 N. benthamiana  plants sown into CGMMV infested soil and tested for the presence of CGMMV.

Journal: Plants

Article Title: Investigating the Longevity and Infectivity of Cucumber green mottle mosaic virus in Soils of the Northern Territory, Australia

doi: 10.3390/plants11070883

Figure Lengend Snippet: N. benthamiana plants sown into CGMMV infested soil and tested for the presence of CGMMV.

Article Snippet: Watermelon and N. benthamiana seedlings for soil disinfection and infectivity trials were grown at Berrimah Farm and were approximately four weeks old at the time of each trial.

Techniques:

 N. benthamiana  inoculated with CGMMV mixed with 2% Virkon TM or 1% Bleach at three separate contact times.

Journal: Plants

Article Title: Investigating the Longevity and Infectivity of Cucumber green mottle mosaic virus in Soils of the Northern Territory, Australia

doi: 10.3390/plants11070883

Figure Lengend Snippet: N. benthamiana inoculated with CGMMV mixed with 2% Virkon TM or 1% Bleach at three separate contact times.

Article Snippet: Watermelon and N. benthamiana seedlings for soil disinfection and infectivity trials were grown at Berrimah Farm and were approximately four weeks old at the time of each trial.

Techniques:

Symptomology (Red circles) of CGMMV on N. benthamiana planted into infested soil treated with ( A ) 2% Virkon TM and ( B ) untreated soil.

Journal: Plants

Article Title: Investigating the Longevity and Infectivity of Cucumber green mottle mosaic virus in Soils of the Northern Territory, Australia

doi: 10.3390/plants11070883

Figure Lengend Snippet: Symptomology (Red circles) of CGMMV on N. benthamiana planted into infested soil treated with ( A ) 2% Virkon TM and ( B ) untreated soil.

Article Snippet: Watermelon and N. benthamiana seedlings for soil disinfection and infectivity trials were grown at Berrimah Farm and were approximately four weeks old at the time of each trial.

Techniques:

Survival rate of bioassays using specific stages of larval instars on WT and ASAT2 plants of N. benthamiana . Values are presented as means ± SE. Asterisks above error bars indicate significant differences ( P < 0.05).

Journal: Frontiers in Plant Science

Article Title: Acylsugar protection of Nicotiana benthamiana confers mortality and transgenerational fitness costs in Spodoptera litura

doi: 10.3389/fpls.2022.993279

Figure Lengend Snippet: Survival rate of bioassays using specific stages of larval instars on WT and ASAT2 plants of N. benthamiana . Values are presented as means ± SE. Asterisks above error bars indicate significant differences ( P < 0.05).

Article Snippet: The wild-type (WT) and the acylsugar-deficient asat2-1 line (ASAT2) plants of N. benthamiana were obtained from the Boyce Thompson Institute, Ithaca, New York, USA, and the ASAT2 plants showed an almost complete absence of acylsugar compared to the WT plants (Feng et al., ).

Techniques:

Survival rate (A) and weight of individual (B) in each larval stage of the F 0 generation on WT and ASAT2 plants of N. benthamiana . Values are presented as means ± SE. Asterisks above error bars indicate significant differences ( P < 0.05).

Journal: Frontiers in Plant Science

Article Title: Acylsugar protection of Nicotiana benthamiana confers mortality and transgenerational fitness costs in Spodoptera litura

doi: 10.3389/fpls.2022.993279

Figure Lengend Snippet: Survival rate (A) and weight of individual (B) in each larval stage of the F 0 generation on WT and ASAT2 plants of N. benthamiana . Values are presented as means ± SE. Asterisks above error bars indicate significant differences ( P < 0.05).

Article Snippet: The wild-type (WT) and the acylsugar-deficient asat2-1 line (ASAT2) plants of N. benthamiana were obtained from the Boyce Thompson Institute, Ithaca, New York, USA, and the ASAT2 plants showed an almost complete absence of acylsugar compared to the WT plants (Feng et al., ).

Techniques:

Development time (A) and longevity of adults (B) of the F 0 generation on WT and ASAT2 plants of N. benthamiana . Values are presented as means ± SE. Asterisks above error bars indicate significant differences ( P < 0.05), and n.s. indicates not significant ( P > 0.05).

Journal: Frontiers in Plant Science

Article Title: Acylsugar protection of Nicotiana benthamiana confers mortality and transgenerational fitness costs in Spodoptera litura

doi: 10.3389/fpls.2022.993279

Figure Lengend Snippet: Development time (A) and longevity of adults (B) of the F 0 generation on WT and ASAT2 plants of N. benthamiana . Values are presented as means ± SE. Asterisks above error bars indicate significant differences ( P < 0.05), and n.s. indicates not significant ( P > 0.05).

Article Snippet: The wild-type (WT) and the acylsugar-deficient asat2-1 line (ASAT2) plants of N. benthamiana were obtained from the Boyce Thompson Institute, Ithaca, New York, USA, and the ASAT2 plants showed an almost complete absence of acylsugar compared to the WT plants (Feng et al., ).

Techniques:

Fecundity (A) , oviposition duration (B) , and egg hatching rate (C) of the F 0 generation of S. litura on WT and ASAT2 plants of N. benthamiana . Values are presented as means ± SE. Asterisks above error bars indicate significant differences ( P < 0.05), and n.s. indicates not significant ( P > 0.05).

Journal: Frontiers in Plant Science

Article Title: Acylsugar protection of Nicotiana benthamiana confers mortality and transgenerational fitness costs in Spodoptera litura

doi: 10.3389/fpls.2022.993279

Figure Lengend Snippet: Fecundity (A) , oviposition duration (B) , and egg hatching rate (C) of the F 0 generation of S. litura on WT and ASAT2 plants of N. benthamiana . Values are presented as means ± SE. Asterisks above error bars indicate significant differences ( P < 0.05), and n.s. indicates not significant ( P > 0.05).

Article Snippet: The wild-type (WT) and the acylsugar-deficient asat2-1 line (ASAT2) plants of N. benthamiana were obtained from the Boyce Thompson Institute, Ithaca, New York, USA, and the ASAT2 plants showed an almost complete absence of acylsugar compared to the WT plants (Feng et al., ).

Techniques:

Development time (A) and survival rate (B) of the F 1 generation on WT and ASAT2 plants of N. benthamiana . Values are presented as means ± SE. Asterisks above error bars indicate significant differences ( P < 0.05), and n.s. indicates not significant ( P > 0.05).

Journal: Frontiers in Plant Science

Article Title: Acylsugar protection of Nicotiana benthamiana confers mortality and transgenerational fitness costs in Spodoptera litura

doi: 10.3389/fpls.2022.993279

Figure Lengend Snippet: Development time (A) and survival rate (B) of the F 1 generation on WT and ASAT2 plants of N. benthamiana . Values are presented as means ± SE. Asterisks above error bars indicate significant differences ( P < 0.05), and n.s. indicates not significant ( P > 0.05).

Article Snippet: The wild-type (WT) and the acylsugar-deficient asat2-1 line (ASAT2) plants of N. benthamiana were obtained from the Boyce Thompson Institute, Ithaca, New York, USA, and the ASAT2 plants showed an almost complete absence of acylsugar compared to the WT plants (Feng et al., ).

Techniques:

Fecundity (A) , oviposition duration (B) , and egg hatching rate (C) of the F 1 generation of S. litura on WT and ASAT2 plants of N. benthamiana . Values are presented as means ± SE. Asterisks above error bars indicate significant differences ( P < 0.05), and n.s. indicates not significant ( P > 0.05).

Journal: Frontiers in Plant Science

Article Title: Acylsugar protection of Nicotiana benthamiana confers mortality and transgenerational fitness costs in Spodoptera litura

doi: 10.3389/fpls.2022.993279

Figure Lengend Snippet: Fecundity (A) , oviposition duration (B) , and egg hatching rate (C) of the F 1 generation of S. litura on WT and ASAT2 plants of N. benthamiana . Values are presented as means ± SE. Asterisks above error bars indicate significant differences ( P < 0.05), and n.s. indicates not significant ( P > 0.05).

Article Snippet: The wild-type (WT) and the acylsugar-deficient asat2-1 line (ASAT2) plants of N. benthamiana were obtained from the Boyce Thompson Institute, Ithaca, New York, USA, and the ASAT2 plants showed an almost complete absence of acylsugar compared to the WT plants (Feng et al., ).

Techniques:

The size distribution of sequenced small RNA reads. The size class distribution of redundant and non redundant small RNA sequences in the twelve tissue samples. The percentage of the different size classes (y-axis) and the different tissues, which includes seedling, root, leaf, stem and flower with biological replicates and BTI seedling and leaf cDNA libraries (x-axis) represented in N. benthamiana

Journal: BMC Genomics

Article Title: Identification of Nicotiana benthamiana microRNAs and their targets using high throughput sequencing and degradome analysis

doi: 10.1186/s12864-015-2209-6

Figure Lengend Snippet: The size distribution of sequenced small RNA reads. The size class distribution of redundant and non redundant small RNA sequences in the twelve tissue samples. The percentage of the different size classes (y-axis) and the different tissues, which includes seedling, root, leaf, stem and flower with biological replicates and BTI seedling and leaf cDNA libraries (x-axis) represented in N. benthamiana

Article Snippet: To validate the tissue-specific expression patterns of selected conserved and known miRNAs we carried out Northern blot analysis using seedling (Se), root (R), leaf (L), stem (St) and flower (F) samples isolated from our N. benthamiana line; and leaf (L BTI ) and seedling (Se BTI ) samples from N. benthamiana Nb-1 accession that were obtained from the Boyce Thompson Institute for Plant Research.

Techniques:

Conserved and other known miRNAs in N. benthamiana . Normalized read numbers of conserved and other known miRNAs across the tissues included in this study. Expression profiles are expressed in reads per million (RPM) genome matching reads. Heat map colours represents absolute normalized levels of miRNA expression ranging from less than 1 RPM (white) to more than 1000 RPM (red) as indicated in the colour key. We have identified 40 known or conserved miRNA families in the twelve sRNA libraries generated. All of the deeply conserved miRNA families (miR156/157, miR159/319, miR160, miR165/166, miR171, miR408, miR390/391 and miR395) were present in our data sets. The expression levels of different miRNA families were different and we also observed clear tissue-specific expressional changes within some miRNA families as it was expected

Journal: BMC Genomics

Article Title: Identification of Nicotiana benthamiana microRNAs and their targets using high throughput sequencing and degradome analysis

doi: 10.1186/s12864-015-2209-6

Figure Lengend Snippet: Conserved and other known miRNAs in N. benthamiana . Normalized read numbers of conserved and other known miRNAs across the tissues included in this study. Expression profiles are expressed in reads per million (RPM) genome matching reads. Heat map colours represents absolute normalized levels of miRNA expression ranging from less than 1 RPM (white) to more than 1000 RPM (red) as indicated in the colour key. We have identified 40 known or conserved miRNA families in the twelve sRNA libraries generated. All of the deeply conserved miRNA families (miR156/157, miR159/319, miR160, miR165/166, miR171, miR408, miR390/391 and miR395) were present in our data sets. The expression levels of different miRNA families were different and we also observed clear tissue-specific expressional changes within some miRNA families as it was expected

Article Snippet: To validate the tissue-specific expression patterns of selected conserved and known miRNAs we carried out Northern blot analysis using seedling (Se), root (R), leaf (L), stem (St) and flower (F) samples isolated from our N. benthamiana line; and leaf (L BTI ) and seedling (Se BTI ) samples from N. benthamiana Nb-1 accession that were obtained from the Boyce Thompson Institute for Plant Research.

Techniques: Expressing, Generated

Expression analysis of selected conserved and other known miRNAs in different N. benthamiana tissues. Total RNA was extracted from different tissues including, seedling (Se), root (R), leaf (L), stem (St), flower (F) from N. benthamiana plants used in our laboratory and from plants from Boyce Thompson Institute (leaf BTI - L BTI , seedling BTI - Se BTI ). The RNA was separated on PAGE and transferred to nylon membranes for Northern blot analysis of the miRNAs. Oligonucleotide probes were used to detect specific miRNAs, and an U6-specific probe was used to detect U6 RNA as a loading control for each membrane

Journal: BMC Genomics

Article Title: Identification of Nicotiana benthamiana microRNAs and their targets using high throughput sequencing and degradome analysis

doi: 10.1186/s12864-015-2209-6

Figure Lengend Snippet: Expression analysis of selected conserved and other known miRNAs in different N. benthamiana tissues. Total RNA was extracted from different tissues including, seedling (Se), root (R), leaf (L), stem (St), flower (F) from N. benthamiana plants used in our laboratory and from plants from Boyce Thompson Institute (leaf BTI - L BTI , seedling BTI - Se BTI ). The RNA was separated on PAGE and transferred to nylon membranes for Northern blot analysis of the miRNAs. Oligonucleotide probes were used to detect specific miRNAs, and an U6-specific probe was used to detect U6 RNA as a loading control for each membrane

Article Snippet: To validate the tissue-specific expression patterns of selected conserved and known miRNAs we carried out Northern blot analysis using seedling (Se), root (R), leaf (L), stem (St) and flower (F) samples isolated from our N. benthamiana line; and leaf (L BTI ) and seedling (Se BTI ) samples from N. benthamiana Nb-1 accession that were obtained from the Boyce Thompson Institute for Plant Research.

Techniques: Expressing, Northern Blot, Control, Membrane

Targets of conserved and other known miRNAs in Nicotiana  benthamiana  a

Journal: BMC Genomics

Article Title: Identification of Nicotiana benthamiana microRNAs and their targets using high throughput sequencing and degradome analysis

doi: 10.1186/s12864-015-2209-6

Figure Lengend Snippet: Targets of conserved and other known miRNAs in Nicotiana benthamiana a

Article Snippet: To validate the tissue-specific expression patterns of selected conserved and known miRNAs we carried out Northern blot analysis using seedling (Se), root (R), leaf (L), stem (St) and flower (F) samples isolated from our N. benthamiana line; and leaf (L BTI ) and seedling (Se BTI ) samples from N. benthamiana Nb-1 accession that were obtained from the Boyce Thompson Institute for Plant Research.

Techniques: Sequencing, Clinical Proteomics, Membrane

Novel miRNAs in N. benthamiana . Normalized read numbers of novel miRNAs across the tissues included in this study. Expression profiles are expressed in reads per million genome matching reads. Heat map colours represents absolute normalized levels of miRNA expression ranging from less than 1 RPM (white) to more than 1000 RPM (red) as indicated in the colour key

Journal: BMC Genomics

Article Title: Identification of Nicotiana benthamiana microRNAs and their targets using high throughput sequencing and degradome analysis

doi: 10.1186/s12864-015-2209-6

Figure Lengend Snippet: Novel miRNAs in N. benthamiana . Normalized read numbers of novel miRNAs across the tissues included in this study. Expression profiles are expressed in reads per million genome matching reads. Heat map colours represents absolute normalized levels of miRNA expression ranging from less than 1 RPM (white) to more than 1000 RPM (red) as indicated in the colour key

Article Snippet: To validate the tissue-specific expression patterns of selected conserved and known miRNAs we carried out Northern blot analysis using seedling (Se), root (R), leaf (L), stem (St) and flower (F) samples isolated from our N. benthamiana line; and leaf (L BTI ) and seedling (Se BTI ) samples from N. benthamiana Nb-1 accession that were obtained from the Boyce Thompson Institute for Plant Research.

Techniques: Expressing

Size distribution and starting nucleotide of the novel N. benthamiana specific miRNAs. The relative abundance of different size categories ( a ), from 20 to 24 nucleotides is shown for the novel miRNAs presented in Fig. . The relative abundance of the 5′-nucleotide ( b ) is shown for the novel miRNAs presented in Fig.

Journal: BMC Genomics

Article Title: Identification of Nicotiana benthamiana microRNAs and their targets using high throughput sequencing and degradome analysis

doi: 10.1186/s12864-015-2209-6

Figure Lengend Snippet: Size distribution and starting nucleotide of the novel N. benthamiana specific miRNAs. The relative abundance of different size categories ( a ), from 20 to 24 nucleotides is shown for the novel miRNAs presented in Fig. . The relative abundance of the 5′-nucleotide ( b ) is shown for the novel miRNAs presented in Fig.

Article Snippet: To validate the tissue-specific expression patterns of selected conserved and known miRNAs we carried out Northern blot analysis using seedling (Se), root (R), leaf (L), stem (St) and flower (F) samples isolated from our N. benthamiana line; and leaf (L BTI ) and seedling (Se BTI ) samples from N. benthamiana Nb-1 accession that were obtained from the Boyce Thompson Institute for Plant Research.

Techniques:

Expression patterns of novel miRNAs found in N. benthamiana . Total RNA was extracted from different tissues including, seedling (Se), root (R), leaf (L), stem (St), flower (F) from N. benthamiana plants used in our laboratory and from plants from Boyce Thompson Institute (leaf BTI - L BTI , seedling BTI - Se BTI ). The RNA was separated on PAGE and transferred to nylon membranes for Northern blot analysis of the novel miRNAs. Oligonucleotide probes were used to detect specific miRNAs, and an U6-specific probe was used to detect U6 RNA as a loading control for each membrane

Journal: BMC Genomics

Article Title: Identification of Nicotiana benthamiana microRNAs and their targets using high throughput sequencing and degradome analysis

doi: 10.1186/s12864-015-2209-6

Figure Lengend Snippet: Expression patterns of novel miRNAs found in N. benthamiana . Total RNA was extracted from different tissues including, seedling (Se), root (R), leaf (L), stem (St), flower (F) from N. benthamiana plants used in our laboratory and from plants from Boyce Thompson Institute (leaf BTI - L BTI , seedling BTI - Se BTI ). The RNA was separated on PAGE and transferred to nylon membranes for Northern blot analysis of the novel miRNAs. Oligonucleotide probes were used to detect specific miRNAs, and an U6-specific probe was used to detect U6 RNA as a loading control for each membrane

Article Snippet: To validate the tissue-specific expression patterns of selected conserved and known miRNAs we carried out Northern blot analysis using seedling (Se), root (R), leaf (L), stem (St) and flower (F) samples isolated from our N. benthamiana line; and leaf (L BTI ) and seedling (Se BTI ) samples from N. benthamiana Nb-1 accession that were obtained from the Boyce Thompson Institute for Plant Research.

Techniques: Expressing, Northern Blot, Control, Membrane

High-throughput sequencing statistics of  N. benthamiana  sRNAs

Journal: BMC Genomics

Article Title: Identification of Nicotiana benthamiana microRNAs and their targets using high throughput sequencing and degradome analysis

doi: 10.1186/s12864-015-2209-6

Figure Lengend Snippet: High-throughput sequencing statistics of N. benthamiana sRNAs

Article Snippet: To validate the tissue-specific expression patterns of selected conserved and known miRNAs we carried out Northern blot analysis using seedling (Se), root (R), leaf (L), stem (St) and flower (F) samples isolated from our N. benthamiana line; and leaf (L BTI ) and seedling (Se BTI ) samples from N. benthamiana Nb-1 accession that were obtained from the Boyce Thompson Institute for Plant Research.

Techniques: Next-Generation Sequencing, Sequencing

Aphids infesting strawberry plants and experimental host plants of strawberry viruses determined in the present study.

Journal: Viruses

Article Title: Molecular and Biological Characterization of a New Strawberry Cytorhabdovirus

doi: 10.3390/v11110982

Figure Lengend Snippet: Aphids infesting strawberry plants and experimental host plants of strawberry viruses determined in the present study.

Article Snippet: Aulacorthum solani (Kaltenbach, 1843), observed feeding on a daughter plant of F. ananassa ČRM1 growing in the experimental field in IPMB, was transferred to F. vesca ‘Alpine’ ( n = 7) and N. benthamiana DCL2/4i ( n = 5) on May 17, 2019.

Techniques: Virus

Plant-produced recombinant proteins on the market

Journal: Nature Reviews Bioengineering

Article Title: Plant-based biopharmaceutical engineering

doi: 10.1038/s44222-023-00044-6

Figure Lengend Snippet: Plant-produced recombinant proteins on the market

Article Snippet: Lectins, growth factors, cytokines , Transient N. benthamiana , Research reagents , iBio, Inc. , https://ibioinc.com/.

Techniques: Recombinant, Expressing, Avidin-Biotin Assay, Transgenic Assay, Virus